Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1974849
End position: 1974884
Length: 36

DNA sequence
>NC_021177, from 1974849 to 1974884 (36 bp); Streptomyces fulvissimus DSM 40593 CGGCCTCCGTCACGGCCTCCGTCGCGGCCTCGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1974506-1975063	Sequence	SFUL_1755 - Acetyltransferase (Protein is coded in complementary strand; from 1975063 to 1974506)