Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1888303
End position: 1888326
Length: 24

DNA sequence
>NC_021177, from 1888303 to 1888326 (24 bp); Streptomyces fulvissimus DSM 40593 CGTAGCCGTTGCCGTTGCCGTAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1888101-1889045	Sequence	SFUL_1677 - hypothetical protein (Protein is coded in complementary strand; from 1889045 to 1888101)