Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 187695
End position: 187730
Length: 36

DNA sequence
>NC_021177, from 187695 to 187730 (36 bp); Streptomyces fulvissimus DSM 40593 AGTCGGGGTGGGGGTCGGAGTGGGGGTCGGGGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 187360-188460	Sequence	SFUL_182 - secreted cellulose binding protein (Protein is coded in complementary strand; from 188460 to 187360)