Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1857619
End position: 1857642
Length: 24

DNA sequence
>NC_021177, from 1857619 to 1857642 (24 bp); Streptomyces fulvissimus DSM 40593 TTCGCGATCGCGCTCGCGCTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1857167-1857796	Sequence	SFUL_1651 - Cell division protein sepF 2 (Protein is coded in complementary strand; from 1857796 to 1857167)