Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1856313
End position: 1856348
Length: 36

DNA sequence
>NC_021177, from 1856313 to 1856348 (36 bp); Streptomyces fulvissimus DSM 40593 ACCCATGGGGCCGCCCATCGGGCCACCCATGGGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1855615-1856760	Sequence	SFUL_1649 - Possibly a cell division protein, antigen 84 in Mycobacteria (Protein is coded in complementary strand; from 1856760 to 1855615)