Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1851339
End position: 1851365
Length: 27

DNA sequence
>NC_021177, from 1851339 to 1851365 (27 bp); Streptomyces fulvissimus DSM 40593 TCGTGGTGCTCGTGGTGCTCGTGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1850768-1851574	Sequence	SFUL_1647 - DNA-binding protein (Protein is coded in complementary strand; from 1851574 to 1850768)