Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1815582
End position: 1815611
Length: 30

DNA sequence
>NC_021177, from 1815582 to 1815611 (30 bp); Streptomyces fulvissimus DSM 40593 GCCGCCGGGCGTCGCCGAGCGCGGCCAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1815221-1816747	Sequence	SFUL_1615 - PucR family transcriptional regulator (Protein is coded in complementary strand; from 1816747 to 1815221)