Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1737578
End position: 1737601
Length: 24

DNA sequence
>NC_021177, from 1737578 to 1737601 (24 bp); Streptomyces fulvissimus DSM 40593 TCGGGGGCGGGGTCGGCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1736854-1738569	Sequence	SFUL_1546 - Secreted protein (Protein is coded in complementary strand; from 1738569 to 1736854)