Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1730371
End position: 1730394
Length: 24

DNA sequence
>NC_021177, from 1730371 to 1730394 (24 bp); Streptomyces fulvissimus DSM 40593 CCGCCGCCGCCACCGCTGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1730275-1731792	Sequence	SFUL_1541 - 30S ribosomal protein S1 (Protein is coded in complementary strand; from 1731792 to 1730275)