Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1710566
End position: 1710589
Length: 24

DNA sequence
>NC_021177, from 1710566 to 1710589 (24 bp); Streptomyces fulvissimus DSM 40593 CGCGGCCGTGGCGGCGGCCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1710411-1711049	Sequence	SFUL_1521 - Integral membrane protein (Protein is coded in complementary strand; from 1711049 to 1710411)