Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1697455
End position: 1697478
Length: 24

DNA sequence
>NC_021177, from 1697455 to 1697478 (24 bp); Streptomyces fulvissimus DSM 40593 GCCGTGGCAGTGGCGGTGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1696948-1697553	Sequence	SFUL_1511 - hypothetical protein (Protein is coded in complementary strand; from 1697553 to 1696948)