Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1683059
End position: 1683082
Length: 24

DNA sequence
>NC_021177, from 1683059 to 1683082 (24 bp); Streptomyces fulvissimus DSM 40593 CCAGCGCCAGCGCCACCGCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1682764-1684293	Sequence	SFUL_1498 - Membrane-flanked domain protein (Protein is coded in complementary strand; from 1684293 to 1682764)