Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1651898
End position: 1651927
Length: 30

DNA sequence
>NC_021177, from 1651898 to 1651927 (30 bp); Streptomyces fulvissimus DSM 40593 CTCCCGTCCCCTCCCCTCCCGTCCCCTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1650876-1653287	Sequence	SFUL_1466 - Serine/threonine protein kinase AfsK