Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1537984
End position: 1538007
Length: 24

DNA sequence
>NC_021177, from 1537984 to 1538007 (24 bp); Streptomyces fulvissimus DSM 40593 CACGGTCCCGGTCACGATCCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1536788-1538149	Sequence	SFUL_1360 - Tetratricopeptide (Protein is coded in complementary strand; from 1538149 to 1536788)