Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1491625
End position: 1491687
Length: 63

DNA sequence
>NC_021177, from 1491625 to 1491687 (63 bp); Streptomyces fulvissimus DSM 40593 GGTAGCTCGGGCGTCCGTCCTGGTAGCTCGAACGCCCGTCCTGGGAACCCGGGCGTCCGCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1490586-1491965	Sequence	SFUL_1321 - Pseudouridine synthase (Protein is coded in complementary strand; from 1491965 to 1490586)