Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1399999
End position: 1400023
Length: 25

DNA sequence
>NC_021177, from 1399999 to 1400023 (25 bp); Streptomyces fulvissimus DSM 40593 GCCGGGGCGGGCCTGGCTGGGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1399535-1400914	Sequence	SFUL_1240 - ABC sugar transporter, ATP-binding subunit (Protein is coded in complementary strand; from 1400914 to 1399535)