Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1395875
End position: 1395901
Length: 27

DNA sequence
>NC_021177, from 1395875 to 1395901 (27 bp); Streptomyces fulvissimus DSM 40593 CCGTAATGGCCGTAGTGGCAGTAATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1394892-1395881	Sequence	SFUL_1236 - Putative integral membrane protein
ORF. 1395847-1396884	Sequence	SFUL_1237 - Polyphosphate kinase 2