Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1324379
End position: 1324402
Length: 24

DNA sequence
>NC_021177, from 1324379 to 1324402 (24 bp); Streptomyces fulvissimus DSM 40593 GTCTCGGTCTCCTTCTCGATCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1323527-1324777	Sequence	SFUL_1169 - Peptidase M50 (Protein is coded in complementary strand; from 1324777 to 1323527)