Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1279234
End position: 1279257
Length: 24

DNA sequence
>NC_021177, from 1279234 to 1279257 (24 bp); Streptomyces fulvissimus DSM 40593 GGCGGAGGCCGAGGCGGTGGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1278638-1279591	Sequence	SFUL_1126 - hypothetical protein (Protein is coded in complementary strand; from 1279591 to 1278638)