Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1228334
End position: 1228378
Length: 45

DNA sequence
>NC_021177, from 1228334 to 1228378 (45 bp); Streptomyces fulvissimus DSM 40593 GGCGCCGGCCTGTCAGGCGCCGACGCGTCAGGCGTCGACCTGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1228377-1228880	Sequence	SFUL_1077 - Acetyltransferase (Protein is coded in complementary strand; from 1228880 to 1228377)