Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1224625
End position: 1224651
Length: 27

DNA sequence
>NC_021177, from 1224625 to 1224651 (27 bp); Streptomyces fulvissimus DSM 40593 CCTTGATGTCCTTGAGGTCCTTGATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1224183-1225049	Sequence	SFUL_1072 - Lipoprotein (Protein is coded in complementary strand; from 1225049 to 1224183)