Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1217594
End position: 1217620
Length: 27

DNA sequence
>NC_021177, from 1217594 to 1217620 (27 bp); Streptomyces fulvissimus DSM 40593 GTGATCGGCGTGATCTGCGTGCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1216350-1217642	Sequence	SFUL_1068 - Uroporphyrin-III C-methyltransferase (Protein is coded in complementary strand; from 1217642 to 1216350)