Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1158360
End position: 1158383
Length: 24

DNA sequence
>NC_021177, from 1158360 to 1158383 (24 bp); Streptomyces fulvissimus DSM 40593 CTGCTGGTGCTGCTGCGGCTGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1156852-1158636	Sequence	SFUL_1007 - integral membrane protein (Protein is coded in complementary strand; from 1158636 to 1156852)