Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1139629
End position: 1139652
Length: 24

DNA sequence
>NC_021177, from 1139629 to 1139652 (24 bp); Streptomyces fulvissimus DSM 40593 CCGCGTCCACGTCCTCGTCCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1139220-1140332	Sequence	SFUL_991 - PYRD Dihydroorotate dehydrogenase (quinone) (Protein is coded in complementary strand; from 1140332 to 1139220)