Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1133250
End position: 1133273
Length: 24

DNA sequence
>NC_021177, from 1133250 to 1133273 (24 bp); Streptomyces fulvissimus DSM 40593 GGGGGCGGGGGCGGTGGCAGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1131651-1133825	Sequence	SFUL_984 - Primosome assembly protein PriA (Protein is coded in complementary strand; from 1133825 to 1131651)