Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2340383
End position: 2340427
Length: 45

DNA sequence
>NC_021177, from 2340383 to 2340427 (45 bp); Streptomyces fulvissimus DSM 40593 CGAAGAGGAAGCCCACGAAGAGGAAGCCCACGAGGACGAGGCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2339965-2340996	Sequence	SFUL_2090 - Metal transport system ABC transporter substrate-binding protein