Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 784166
End position: 784201
Length: 36

DNA sequence
>NC_021177, from 784166 to 784201 (36 bp); Streptomyces fulvissimus DSM 40593 GGTTCGCACGAGGGGTCGCCCGAGGGTTCGTACGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 780342-784721	Sequence	SFUL_667 - coagulation factor 5/8 type domain-containing protein