Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5092387
End position: 5092422
Length: 36

DNA sequence
>NC_021177, from 5092387 to 5092422 (36 bp); Streptomyces fulvissimus DSM 40593 GACCCCCGGACCGACTCCCGGCCCGACCTCCGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 5090503-5092389	Sequence	SFUL_4623 - hypothetical protein
ORF. 5092386-5092796	Sequence	SFUL_4624 - hypothetical protein