Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2737949
End position: 2737984
Length: 36

DNA sequence
>NC_021177, from 2737949 to 2737984 (36 bp); Streptomyces fulvissimus DSM 40593 CACCCTGCTCGCCACCGTGCTCGGCACCCTGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2737885-2738526	Sequence	SFUL_2420 - ABC polar amino acid family transporter