Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2589447
End position: 2589482
Length: 36

DNA sequence
>NC_021177, from 2589447 to 2589482 (36 bp); Streptomyces fulvissimus DSM 40593 GGCTCGGACTGGGACTGGGACTGGGACTGGGACTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2588941-2589447	Sequence	SFUL_2295 - hypothetical protein
ORF. 2589420-2589812	Sequence	SFUL_2296 - hypothetical protein (Protein is coded in complementary strand; from 2589812 to 2589420)