Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 845049
End position: 845078
Length: 30

DNA sequence
>NC_021177, from 845049 to 845078 (30 bp); Streptomyces fulvissimus DSM 40593 ACCGGCACCGCCACCAGCTCCGGCTCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 844543-845424	Sequence	SFUL_723 - Putative transmembrane anti-sigma factor (Protein is coded in complementary strand; from 845424 to 844543)