Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5044712
End position: 5044738
Length: 27

DNA sequence
>NC_021177, from 5044712 to 5044738 (27 bp); Streptomyces fulvissimus DSM 40593 CCCCCCTCACCCCCTTCACCCCCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5044214-5045920	Sequence	SFUL_4587 - LPXTG-motif cell wall anchor domain protein