Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 264169
End position: 264195
Length: 27

DNA sequence
>NC_021177, from 264169 to 264195 (27 bp); Streptomyces fulvissimus DSM 40593 GGGCTCGGCGGGCTCGGCGGGCCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 263942-264475	Sequence	SFUL_238 - hypothetical protein (Protein is coded in complementary strand; from 264475 to 263942)