Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7125764
End position: 7125787
Length: 24

DNA sequence
>NC_021177, from 7125764 to 7125787 (24 bp); Streptomyces fulvissimus DSM 40593 GCCCCCGCCGCCGCCCACGCCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7124979-7126205	Sequence	SFUL_6351 - Aspartate/tyrosine aromatic aminotransferase-like protein