Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4684232
End position: 4684255
Length: 24

DNA sequence
>NC_021177, from 4684232 to 4684255 (24 bp); Streptomyces fulvissimus DSM 40593 TCCATGTCCATGTCCAAGTCCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4684236-4685288	Sequence	SFUL_4213 - ABC transport system ATP-binding protein