Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 648348
End position: 648371
Length: 24

DNA sequence
>NC_021171, from 648348 to 648371 (24 bp); Bacillus sp. 1NLA3E CACTATCATTATCACGATCAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 647981-648385	Sequence	B1NLA3E_02900 - hypothetical protein (Protein is coded in complementary strand; from 648385 to 647981)