Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 4520424
End position: 4520447
Length: 24

DNA sequence
>NC_021171, from 4520424 to 4520447 (24 bp); Bacillus sp. 1NLA3E TAAAAATATAAATAAAATTAAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4519495-4520751	Sequence	B1NLA3E_20905 - WblL protein (Protein is coded in complementary strand; from 4520751 to 4519495)