Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 4205924
End position: 4205947
Length: 24

DNA sequence
>NC_021171, from 4205924 to 4205947 (24 bp); Bacillus sp. 1NLA3E ATCCATATCTATATCCAAATCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4205716-4205958	Sequence	B1NLA3E_19500 - hypothetical protein (Protein is coded in complementary strand; from 4205958 to 4205716)