Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 4132316
End position: 4132339
Length: 24

DNA sequence
>NC_021171, from 4132316 to 4132339 (24 bp); Bacillus sp. 1NLA3E CGCCGCCGCCCCAGCCGCCGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4131169-4133511	Sequence	B1NLA3E_19170 - anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE (Protein is coded in complementary strand; from 4133511 to 4131169)