Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 3962543
End position: 3962566
Length: 24

DNA sequence
>NC_021171, from 3962543 to 3962566 (24 bp); Bacillus sp. 1NLA3E CAATAACAAGAACATTAATAATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3961869-3962591	Sequence	B1NLA3E_18315 - hypothetical protein (Protein is coded in complementary strand; from 3962591 to 3961869)