Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 3835578
End position: 3835601
Length: 24

DNA sequence
>NC_021171, from 3835578 to 3835601 (24 bp); Bacillus sp. 1NLA3E CCGCTTTCGCTTCCCCTTCTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3834812-3835615	Sequence	B1NLA3E_17725 - alpha/beta fold family hydrolase (Protein is coded in complementary strand; from 3835615 to 3834812)