Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 3784509
End position: 3784532
Length: 24

DNA sequence
>NC_021171, from 3784509 to 3784532 (24 bp); Bacillus sp. 1NLA3E TATTTTTCTTTTTTTCTATTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3784509-3785312	Sequence	B1NLA3E_17470 - hypothetical protein (Protein is coded in complementary strand; from 3785312 to 3784509)