Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 3715635
End position: 3715658
Length: 24

DNA sequence
>NC_021171, from 3715635 to 3715658 (24 bp); Bacillus sp. 1NLA3E AATTAATATTAAAAGTAATATTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3715282-3715668	Sequence	B1NLA3E_17170 fxsA phage T7 F exclusion suppressor FxsA (Protein is coded in complementary strand; from 3715668 to 3715282)