Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 3710919
End position: 3710942
Length: 24

DNA sequence
>NC_021171, from 3710919 to 3710942 (24 bp); Bacillus sp. 1NLA3E CAGCTTCTGCTTCAGCTTGAGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3710474-3711742	Sequence	B1NLA3E_17150 - isocitrate dehydrogenase (Protein is coded in complementary strand; from 3711742 to 3710474)