Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 3592474
End position: 3592518
Length: 45

DNA sequence
>NC_021171, from 3592474 to 3592518 (45 bp); Bacillus sp. 1NLA3E TCTCTTTTATTGGCATCTCTTTTATTGGAGCCTCTTTAATCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3591195-3592817	Sequence	B1NLA3E_16600 - spoVID-dependent spore coat assembly factor; FtsK/SpoIIIE family protein; surface protein (Protein is coded in complementary strand; from 3592817 to 3591195)