Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 3503674
End position: 3503700
Length: 27

DNA sequence
>NC_021171, from 3503674 to 3503700 (27 bp); Bacillus sp. 1NLA3E ACCTTGAGCGCCTTGAGCAGCTTGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3503606-3505438	Sequence	B1NLA3E_16180 dnaK molecular chaperone DnaK (Protein is coded in complementary strand; from 3505438 to 3503606)