Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 3364472
End position: 3364498
Length: 27

DNA sequence
>NC_021171, from 3364472 to 3364498 (27 bp); Bacillus sp. 1NLA3E GCTACTGGTGCAACTGGTGCTACCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3364127-3364633	Sequence	B1NLA3E_15475 - biotin carboxyl carrier protein of acetyl-CoA carboxylase (BCCP) (Protein is coded in complementary strand; from 3364633 to 3364127)