Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 2803957
End position: 2803980
Length: 24

DNA sequence
>NC_021171, from 2803957 to 2803980 (24 bp); Bacillus sp. 1NLA3E TCCTCATCCTCTTCATCATCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2803627-2804295	Sequence	B1NLA3E_12695 - hypothetical protein (Protein is coded in complementary strand; from 2804295 to 2803627)