Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 2772137
End position: 2772181
Length: 45

DNA sequence
>NC_021171, from 2772137 to 2772181 (45 bp); Bacillus sp. 1NLA3E AGCAGTTCGCGGCGTAGCAGTTCTCGGCGTAGCAGTTCTCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2772067-2772282	Sequence	B1NLA3E_12555 - hypothetical protein (Protein is coded in complementary strand; from 2772282 to 2772067)