Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 2768797
End position: 2768832
Length: 36

DNA sequence
>NC_021171, from 2768797 to 2768832 (36 bp); Bacillus sp. 1NLA3E TTGATTATTATTTTGATTATTATTTTGATTATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2768354-2769427	Sequence	B1NLA3E_12540 - spore coat protein B (outer) (Protein is coded in complementary strand; from 2769427 to 2768354)